Full text of "USPTO Patents Application 09993647"

See other formats

(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT)

(19) World Intellectual Property Organization

International Bureau

(43) International Publication Date
2 August 2001 (02.08.2001)

PCT

lllllllllilllllllllllllllllli

(10) International Publication Number

WO 01/54723 Al

(51) International Patent Ciassification^: A61K 39/395, (74) Agent: SOMERVILLE, Deborah, A.; Kenyon &
39/00, 39/38, GOIN 33/53 Kenyon, One Broadway, New York, NY 10004 (US).

(21) International Application Number: PCT/USO 1/02839

(22) International Filing Date: 29 January 2001 (29.0L2001)

(25) Filing Language:

(26) Publication Language:

English

(30) Priority Data:

60/178,791
09/539,692

28 January 2000 (28.01 .2000) US
31 March 2000 (31.03.2000) US

(71) Applicant (for all designated States except BB, US): SUN-
NYBROOK HEALTH SCIENCE CENTER [CA/CA];
2075 Bayview Avenue, North York, Ontario M4N 3M5
(CA).

(71) Applicant (for BB only): IMCLONE SYSTEMS IN-
CORPORATED [US/US]; 180 Varick Street, New York,
NY 10014 (US).

(72) Inventor; and

(75) Inventor/Applicant (for US only): KERBEL, Robert

[CA/CA]; 48 Bennington Heights Drive, Toronto, Ontario
M4G 1A9 (CA).

(81) Designated States (national): AE, AG, AL, AM, AT, AU,
AZ, BA, BB, BG, BR, BY, BZ, CA, CH, CN, CR, CU, CZ,
DE, DK, DM, DZ, EE, ES, FI, GB, GD, GE, GH, GM, HR,
HU, ID, XL, IN, IS, JP, KE, KG, KP, KR, KZ, LC, LK, LR,
LS, LT, LU, LV, MA, MD, MG, MK, MN, MW, MX, MZ,
NO, NZ, PL, PT, RO, RU, SD, SE, SG, SI, SK, SL, TJ, TM,
TR, TT, TZ, UA, UG, US, UZ, VN, YU, ZA, ZW.

(84) Designated States (regional): ARIPO patent (GH, GM,
KE, LS, MW, MZ, SD, SL, SZ, TZ, UG, ZW), Eurasian
patent (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM), European
patent (AT, BE, CH, CY, DE, DK, ES, FI, FR, GB, GR, IE,
IT, LU, MC, NL, PT, SE, TR), OAPI patent (BF, BJ, CF,
CG, CI, CM, GA, GN, GW, ML, MR, NE, SN, TD, TG).

Published:

— with international search report

— before the expiration of the time limit for amending the
claims and to be republished in the event of receipt of
amendments

For two-letter codes and other abbreviations, refer to the "Guid-
ance Notes on Codes and Abbreviations" appearing at the begin-
ning of each regular issue of the PCT Gazette.

f<| (54) Title: THERAPEUTIC METHOD FOR REDUCING ANGIOGENESIS

IT)

(57) Abstract: A method of controlling or treating an angiogenic dependent condition in a mammal, preferably in a human by ad-
ministering an anti-angiogenic molecule such as an angiogenesis growth factor antagonist, and a chemotherapeutic agent in amounts
and frequencies effective, in combination, to produce a regression or arrest of said condition while minimizing or preventing signif-
icant toxicity of the chemotherapeutic agent. Also a kit for controlling or treating an angiogenic dependent condition in a mammal,
preferably in a human, comprising an anti-angiogenic molecule, such as an angiogenesis growth factor antagonist, and a chemothera-
peutic agent in amounts effective, in combination, to produce a regression or arrest of said condition while minimizing or preventing
significant toxicity of the chemotherapeutic agent.

wo 01/54723

PCT/USOl/02839

THERAPEUTIC METHOD FOR REDUCING ANGIOGENESIS

The present application claims the benefit of priority from U.S. Provisional
Application No. 60/178791, filed on January 28, 2000, which is hereby incorporated in its
entirety by reference.

Field of the Invention

The present invention relates to the inhibition or prevention of angiogenesisas a means
to control or treat an angiogenic dependent condition, a condition characterized by, or
dependent upon, blood vessel proliferation. The invention further relates to the use of an anti-
angiogenic molecule in combination with a chemotherapeutic agent.

Background of the Invention

Angiogenesis is a highly complex process of developing new blood vessels that involves
the proliferation and migration of, and tissue infiltration by capillar)^ endothelial cells fi-om pre-
existing blood vessels, cell assembly into tubular stRic^iire?. ' oining of newly forming tubular
assemblies to closed-circuit vascular systems, and maturation of newly formed capillary vessels.
The molecular bases of many of these aspects are still not understood.

Angiogenesis is important in normal physiological processes including embryonic
development, follicular growth, and wound healing, as well as in pathological conditions such as
tumor growth and in non-neoplastic diseases involving abnonnal neovascularization, including
neovascular glaucoma (Folkman, J. and Klagsbrun, M. Science 235:442-447 (1987). Other
disease states include but are not limited to, neoplastic diseases, mcluding but not limited to solid
tumors, autoimmune diseases and collagen vascular diseases such as, for example, rheumatoid
arthritis, and ophthalmalogical conditions such as diabetic retinopathy, retrolental fibroplasia and
neovascular glaucoma. Conditions or diseases to which persistent or uncontrolled angiogenesis
contribute have been termed angiogenic dependent or angiogenic associated diseases.

One means of controlling such diseases and pathological conditions comprises restricting
the blood supply to those cells involved in mediating or causing the disease or condition. For
example, in the case of neoplastic disease, solid tumors develop to a size of about a few
millimeters, and further growth is not possible, absent angiogenesis within the tumor. In the past.

wo 01/54723

PCT/USOl/02839

strategies to limit the blood supply to tumors have included occluding blood vessels supplying
portions of organs in which tumors are present. Such approaches require the site of the tumor to
be identified and are generally limited to treatment to a single site, or small number of sites. An
additional disadvantage of direct mechanical restriction of a blood supply is that collateral blood
vessels develop, often quite rapidly, restoring the blood supply to the tumor.

Other approaches have focused on the modulation of factors that are involved in the
regulation of angiogenesis. While usually quiescent, vascular endothelial proliferation is highly
regulated, even during angiogenesis. Examples of factors that have been implicated as possible
regulators of angiogenesis in vivo include, but are not limited to, transforming growth factor beta
(TGFp), acidic and basic fibroblast growth factor (aFGF and bFGF), platelet derived growth
factor (PDGF), and vascular endothelial growth factor (VEGF) (Klagsbrun, M. and D'Amore, P.

(1991) Annual Rev. Physiol. 53: 217-239).

One growth factor of particular interest is VEGF. An endothelial-cell specific mitogen,
VEGF acts as an angiogenesis inducer by specifically promoting the proliferation of endothelial
ceils. It is a homodimeric glycoprotein consisting of two 23 kD subunits with structural similarity
to PDGF, Four different monomeric isoforms of VEGF resulting fi-om altemative splicing of
n-iRN.A ; J been identi. ;ed ^hese include two membrane bound forms (VEGF206 and VEGFjgg)
^. : ;v e toims • ' ' i and VEGF, 3,). VEGF,^,s is the most abundant isoform in all

huniun -Mies except . - .

\ LGF is expres^-j.. - embryonic tissues (Breier et al.. Development (Camb.) 1 14:521

(1992) ), macrophages, and proliferating epidermal keratinocytes during wound healing (Brown et
al., J, Exp. Med., 176:1375 (1992)), and may be responsible for tissue edema associated with
inflammation (Fenrara et al., Endocr. Rev. 13:18 (1992)). In situ hybridization studies have
demonstrated high levels of VEGF expression in a number of human tumor lines including
glioblastoma multiforme, hemangioblastoma, other central nervous system neoplasms and AIDS-
associated Kaposi^s sarcoma (Plate, K. et al. (1992) Nature 359: 845-848; Plate, K. et al. (1993)
Cancer Res. 53: 5822-5827; Berkman, R. et al. (1993) J. Clin. Invest. 91: 153-159; Nakamura, S.
et al. (1992) AIDS Weekly, 13(1)). High levels of VEGF also have been reported in hypoxia
induced angiogenesis (Shweiki, D. et al. (1992) Nature 359: 843-845).

VEGF mediates its biological effect through high affinity VEGF receptors which are
selectively expressed on endothelial cells during, for example, embryogenesis (Millauer, B., et al.

(1993) Cell 72: 835-846) and tumor formation. VEGF receptors typically are class III receptor-
type tyrosine kinases characterized by having several, typically 5 or 7, immunoglobulin-like loops

wo 01/54723

PCT/USOl/02839

in their amino-terminal extracellialar receptor ligand-binding domains (Kaipainen et al., J. Exp.
Med. 178:2077-2088 (1993)). The other two regions include a transmembrane region and a
carboxy-terminal intracellular catalytic domain interrupted by an insertion of hydrophilic
interkinase sequences of variable lengths, called the kinase insert domain (Terman et al,.
Oncogene 6:1677-1683 (1991)). VEGF receptors include flt-1, sequenced by Shibuya M. et al..
Oncogene 5, 519-524 (1990); flk-1, sequenced by Matdiews W. et al. Proc. Natl. Acad. Sci. USA,
88:9026-9030 (1991) and KDR the human homologue of flk-1, described in PCT/US92/01300,
filed Februaiy 20, 1992, and in Temian et al.. Oncogene 6:1677-1683 (1991).

High levels of flk-1 are expressed by endothelial cells that infiltrate gliomas (Plate, K. et
al., (1992) Nature 359: 845-848), and are specifically upregulated by VEGF produced by human
glioblastomas (Plate, K. et al. (1993) Cancer Res. 53: 5822-5827). The finding of high levels of
flk-1 expression in glioblastoma associated endothelial cells (GAEC) suggests that receptor
activity is induced during tumor fomiation, since flk- 1 transcripts are barely detectable in normal
brain endothelial cells. This upregulation is confined to the vascular endothelial cells in close
proximity to the tumor. Blocking VEGF activity with neutralizing anti-VEGF monoclonal
antibodies (mAbs) results in inhibition of the growth of human tumor xenografts in nude mice
(Kim. K. et al. (1993) Nature 362: 841-844), suggesting a direct role for VEGF in tumor-related
angiogener:".

Various chemotherapeutic drugs also have been showii to block fiinctions of activated,
dividing endothelial cells critical to angiogenesis, or to kill such cells. Such collateral damaging
effects on a genetically stable normal host cell, in addition to the chemotherapeutic agent's effect
upon the tumor cells, contribute significantly to the in vivo anti-tumor efficacy of chemotherapy .
However, the standard use of chemotherapeutic agents has obvious undesirable side-effects upon
the normal cells of patients, limiting its use. Administration of chemotherapeutic agents in their
usual doses and at usual dosage fi-equencies are commonly associated with side-effects, including,
but not limited to, myelosuppression, neurotoxicity, cardiotoxicity, alopecia, nausea and vomiting,
nephrotoxicity, and gastrointestinal toxicity. Further, patients' tumors often also develop
resistance to the chemotherapeutic agents after initial exposure to the drugs.

A desirable method and composition for controlling angiogenesis should be well
tolerated, have few or no side-effects, and prevent new vessel formation at sites of disease
without interfering with required physiologic angiogenesis in normal sites. It should be
effective and, in the case of neoplastic disease, overcome the problem of the development of
drug resistance by tumor cells. In so doing, it should permit targeted therapy without the

wo 01/54723

PCT/USOl/02839

accurate identification of all disease sites. The present invention addresses many of the
problems with existing materials and methods.

SUMMARY OF THE INVENTION

The present invention provides a method of treating an angiogenic dependent
condition in a mammal comprising administering an anti-angiogenic molecule and a
chemotherapeutic agent to the mammal, in an amount and frequency effective, in
combination, to produce a regression or arrest of the condition without significant toxicity

10 from the chemotherapeutic agent. The angiogenic dependent condition may be selected from
the group consisting of neoplasm, collagen-vascular disease or auto-immune disease,
including a solid tumor neoplasm, including breast carcinoma, lung carcinoma, prostate
carcinoma, colon carcinoma, prostate carcinoma, ovarian carcinoma, neuroblastoma, central
nervous system tumor, neuroblastoma, glioblastoma multiforme or melanoma. The mammal

15 receiving the treatment is preferably a human.

The anti-angiogenic molecules inhibit the action of a vascular endothelium survival
factor, which include receptors and their ligands. Vascular endothelium survival factors
include /.c. * ^.eluding angiogenic growth factors such as VFC receptor, including flk-
1/KDR receptor, or flt-4 receptor and VEGF. Examples of other vascular endothelial survival

20 factors are integnn ayp., ttvP:. Hgand, Tie2/tek ligand. Tie2/tek. endoglin ligand, endoglin,
neuropilin ligand, neuropilin, thrombospondin ligand, thrombospondin, PDGFa, PDGFa
receptor, PDGFp, PDGFp receptor, aFGF, aFGF receptor, bFGF, bFGF receptor, TGFp,
TGFp receptor, EGF, EGF receptor, angiostatin, angiostatin receptor, angiopoetin,
angiopoeitin receptor, PLGF, PLGF receptor, VPF, or VPF receptor. Optionally, the ligand is

25 selected from the group consisting of VEGF (VEGF-A), VEGF-B, VEGF-C, or VEGF-D.
The anti-angiogenic molecule may be selected from the group consisting of antibody,
antibody fragment, small molecule or peptide.

Preferred embodiments of the present invention include antibodies selected from the
group consisting of mouse antibody, rat antibody, chimeric antibody, humanized antibody or

30 human antibody. A preferred antibody is IMC-lCl 1 .

Preferably, IMC-lCll is administered in a dose of from about 5 mg/m- to about 700
mg/nr about daily to about every 7 days, more preferably a dose of from about 7.5 mg/m- to
about 225 mg/m-, about twice per week. Optionally, the IMC- 1 CI 1 is administered at a dose

wo 01/54723

PCT/USOl/02839

and frequency sufficient to substantially saturate the VEGF receptor. Optionally, the anti-
angiogenic molecule is administered in a dose and frequency sufficient to substantially
saturate the target of the anti-angiogenic molecule. In another embodiment, the anti-
angiogenic molecule is administered in a dose equivalent to that of IMC-lCll, administered
5 in a dose of from about 5 mg/m^ to about 700 mg/m^ about daily to about every 7 days, more
preferably a dose of from about 7.5 mg/m^ to about 225 mg/m^, about twice per week.

The chemotherapeutic agent may be selected from the group consisting of vinca
alkaloid, camptoihecan, taxane, or platinum analogue, including vincristine, vinblastine,
vinorelbine, vindesine, paclitaxel, docetaxel, 5 FU, cisplatin, carboplatin, iranotecan,

10 topotecan or cyclophosphamide. The chemotherapeutic agent is administered in a low-dose
regimen. Preferably the chemotherapeutic agent is administered at less than about 20% of the
maximum tolerated dose, more preferably at less than about 15% of the maximum tolerated
dose, more preferably at less than about 10% of the maximum tolerated dose, more preferably
at less than about 5% of the maximum tolerated dose, and most preferably at less than about

15 2% of the maximum tolerated dose. In one embodiment of the invention the

chemotherapeutic agent is administered at a dose intensity less than about 20% of the dose
intensity of the chemotherapeutic agent when used in a conventional chem. ^therapeutic
regimen, pref:ra*' !y at Jose intensity less than about 10% of the dose inte ; of the
chemotherapeutic agent when used in a conventional chemotherapeutic reeimen, and more

20 preferably at a dose intensity less than about 5% of the dose intensity of the chemotherapeutic
agent when used in a conventional chemotherapeutic regimen.

In one preferred embodiment the vinblastine is administered in a dose from about 0.5
mg/nr to about 3 mg/m* from about once every 3 days to about once every 7 days. In another
embodiment, the chemotherapeutic agent is administered in a dosage and frequency that is of

25 substantially equivalent efficacy to vinblastine in a dose from about 0.5 mg/m^ to about 3
mg/m- from about once every 3 days to about once every 7 days. Optionally the
chemotherapeutic agent is administered more frequently than about every three weeks, or
more frequently than about every seven days.

The present invention also includes a kit for treating an angiogenic dependent

30 condition in a mammal comprising the anti-angiogenic molecule and the chemotherapeutic
agent, which are provided to be administered in an amount and frequency effective, in
combination, to produce a regression or arrest of the condition while minimizing or
preventing significant toxicity of the chemotherapeutic agent.

wo 01/54723

PCT/USOl/02839

BRIEF DESCRIPTION OF FIGURES

Figure 1 is the encoding nucleotide sequence and deduced amino acid sequence of
and Vl domains of IMC-lCl 1 (c-plCll).

DETAILED DESCRIPTION OF THE INVENTION

Throughout this application, various articles and patents, and patent application are
referenced. Disclosures of all of these publications in their entireties are hereby incorporated
10 by reference into this application.

The present invention comprises a method of treating or controlling an angiogenic
dependent condition in a mammal, comprising administering an anti-angiogenic molecule and
a chemotherapeutic agent in amounts and frequencies effective to produce, in combination, a
regression or arrest of the angiogenic dependent condition, while minimizing or preventing
1 5 significant toxicity.

The benefits of the combination of an anti-angiogenic molecule and a
chemotherapeutic agent of the present invention include an improvement in the treatment and
control of an angiogenic dependant condition with reduced doses of a chemothc .peutic agent
administered at increased frequency, without significant toxicity. The combination can be
20 administered for a prolonged period of time, or optionally a shorter duration of treatment may
be administered due to the increased effectiveness of the combination. Toxicity is reduced or
eliminated without a loss of effectiveness. The administration of the treatment of the
invention can overcome the problems of drug resistance that develops with standard
chemotherapeutic regimens.

The anti-angiogenic molecule functions to inhibit or prevent angiogenesis, thereby
treating or controlling the angiogenic dependent condition by inhibiting or blocking
(antagonizing) the effect of vascular endothelial survival factors. These survival factors are
receptors or their ligands, upon which vascular endothelium depends, either directly or
30 indirectly, for growth and/or survival. They play a role in allowing vascular endothelial cells
to recovery from injury or insult, which, absent the effect of the survival factor would result
in cell death or apoptosis. Survival factors include vascular endothelial cell growth factors or
mitogens, as well as those factors which do not appear to have a direct growth-stimulatory

wo 01/54723

PCT/USOl/02839

effect but allow the cells to recover from injury.

The survival factors tt at are receptors are located on vascular endothelial cells or
optionally, may be located on other cell types including, but not limited to tumor cells. The
anti -angiogenic molecule inhibit binding to, and/or activation of, receptors, inhibit their
5 expression, or inhibit the binding or expression of ligands.

Examples of survival factors include VEGF receptors, including but not limited to flt-
1 (VEGFRl), flk-l/KDR (VEGFR2), flt-4 (VEGFR3), their ligands VEGF, VEGF-B, VEGF-
C, and VEGF-D, integrin aVp3, Tie2/tek, endoglin (GDI 05), neuropilin, thrombospondin
and their ligands, and PDGFa, PDGFp, aFGF, bFGF, and TGFp, as well as EGF, angiostatin,
10 and angiopoeitin, vascular permiability factor (VPF), and placenta-like growth factor (PLGF)
and their receptors.

Suitable types of anti-angiogenic molecules include, but are not limited to antibody,
antibody fragment, small molecule or peptide. An antibody can be derived from any
mammalian species. Optionally, the antibody is of mouse, rat, rabbit, or human origin.

15 Preferably the antibody is chimeric, more preferably the antibody is humanized, and even
more preferably the antibody is human. Suitable antibody fragments include, for example.
Fab fragment. Fab' fragment, F(ab')T fragment, monovalent single chain antibody (scFv),
and diabodies (DAB ).

Examples of suitable anti-angiogenic molecules that are antagonists to vascular

20 endothelium survival factors include, but are not limited to, VEGF receptor antagonist or
VEGF antagonist, as disclosed in U.S. Patents Nos. 5,840,301, 5,861,499, 5,874,542,
5,955,31 1, and 5,730,977, which are incorporated in their entirety by reference, aFGF
receptor antagonist, aFGF antagonist, bFGF receptor antagonist, bFGF antagonist, PDGF
receptor antagonist, PDGF antagonist, TGFP antagonist, Tie2/tek antagonist (P. Lin et al.,

25 Inhibition of Tumor Angiogenesis Using a Soluble Receptor Establishes a Role for Tie2 in
Pathologic Vascular Growth. J. Clin. Invest. 100(8) 2072 (1997)), endoglin (GDI 05)
antagonist, as disclosed in U.S. Patents Nos 5,855,866, and 5,660,827, neuropilin antagonist,
thrombospondin antagonist, and antagonists to the receptors for PDGFa, PDGpp, aFGF,
bFGF, or TGpp, as well as antagonists to the receptors for EGF, angiostatin, angiopoeitin, or

30 VPF (Vascular Permeability Factor) as disclosed in U.S. Patents Nos. 5,036,003 and

5,659,013. Also encompassed within the scope of the present invention are integrin receptor
antagonists as disclosed in U.S. Patents Nos. 6,017,926, 6,017,925, 5,981,546, 5,952, 341,
and 5,919, 792, integrin avP3 antagonists, as disclosed in U.S. Patents Nos. 5,780,426,

wo 01/54723

PCT/USOl/02839

5,773,412, 5,767,071, 5,759,996, 5,753,230, 5,652,1 10, and 5,652,109, antagonists to
placenta-like growth factor (PLGF) as disclosed in European Patent Application
EP506477A1, thrombospondin antagonists as disclosed in U.S. Patent Nos. 5,840,692,
5,770,563, 5,654,277, 5,648,461, 5,506,208, 5,399,667, 5,200,397, 5,192,744, and 5,190,918,
5 as well as those disclosed in U.S. Patents Nos. 5,965,132, 6,004,555 and 5,877,289, and PCT
Applications Nos. WO 99/16465, WO 97/05250, WO 98/33917. Also included are molecules
such as thalidomide, TNP-470, interferon-a (INF-a), and interleukin- 1 2 (IL-12).

In many cases, the expression of a receptor and/or ligand is upregulated in an region
of angiogenesis. However, although located in an area of abnormal cells responsible for the

10 specific disease, exposed to high levels of ligand, and having upregulated receptors, the cells
of the vascular endothelium are largely normal and responsive to normal regulatory
mechanisms. Because the receptors exist on essentially normal endothelial cells, their
behavior is less likely to escape normal regulatory control. An advantage to blocking a
receptor, rather than its ligand, is that fewer anti-angiogenic molecules may be needed to

1 5 achieve such inhibition, as levels of receptor expression may be more constant than those of
the environmentally induced ligand. Although there are advantages to targeting receptors, it is
also possible, and within the scope of the present invention, to inhibit angiogenesis by
targeting the ligand for the receptor, either alone or in combination with blockade of the
receptor. Optionally, antagonism of the receptor is combined with antagonism of the ligand in

20 order to achieve even more efficient inhibition of angiogenesis.

A preferred embodiment of the invention is the combination of a chemotherapeutic
agent and a VEGF receptor antagonist. It has been shown that a major function of VEGF is to
promote the survival of endothelial cells comprising newly formed vessels (L. E. Benjamin,
et AL, Selective Ablation of Immature Blood Vessels in Established Human Tumors Follows

25 Vascular Endothelial Growth Factor Withdrawal. J,Clin. Invest. 103:159-165 (1999), T. Alon,
et aL, Vascular Endothelial Growth Factor Acts as a Survival Factor for Newly Formed
Retinal Vessels and Has Implications for Retinopathy of Prematurity. Nature Med. 1 : 1024-
1028 (1995), R.K. Jain, et al.. Endothelial Cell Death, Angiogenesis, and Microvascular
Function after Castration in an Androgen-Dependent Tumor: Role of Vascular Endothelial

30 Growth Factor. Proc. Natl Acad. Scl U.S.A. 95:10820-10825 (1998)) Hence, the ability of
such cells to cope with the damage inflicted by continuous or frequent exposure to a
chemotherapeutic drug is selectively and significantly impaired when they are exposed to a
VEGF receptor antagonist, ( M. J. Prewett, et al., Antivascular Endothelial Growth Factor

wo 01/54723

PCT/USOl/02839

Receptor (Fetal Liver Kinase 1) Monoclonal Antibody Inhibits Tumor Angiogenesis and
Growth of Several Mouse and Human Tumors. Cancer Res 59:5209-5218. (1999); T. A.
Fong, et al., SU5416 Is a Potent and Selective Inhibitor of the Vascular Endothelial Growth
Factor Receptor (Flk-l/kdr) That Inhibits Tyrosine Kinase Catalysis, Tumor Vascularization,
5 and Growth of Multiple Tumor Types. Cancer Res 59:99-106 (1999); N. Ferrara, et al..

Clinical Applications of Angiogenic Growth Factors and Their Inhibitors. Nat.Med. 5:1359-
1364. (1999)). It is believed that the combination of continuous or frequent chemotherapy
with, for example, interruption of the cell rescue mechanisms provided by activation of the
VEGF receptor plays a role in inducing vascular endothelial cell apoptosis.

10 In a preferred embodiment of the invention, the anti-angiogenic molecule is an

antagonist to VEGF or the VEGF receptor. While the expression of the VEGF receptor and
ligand is low in normal endothelial cells that are not in or near a region of angiogenesis,
VEGF receptors present on tumor infiltrating vascular endothelial cells are upregulated, as is
the expression of the VEGF ligand by tumor cells. Blocking the interaction between VEGF

15 and its receptors can inhibit angiogenesis, and thereby tumor growth, while not significantly
effecting normal endothelial cells at other sites, where vascular endothelial cell receptors have
not been upregulated. In one embodiment of the present invention, antagonism of the VEGF
receptor is combined with antagonism of the VEGF ligand in order to achieve even more
efficient inhibition of angiogenesis. In other embodiments of the invention antagonists to one

20 or more than one of the VEGF receoptors or ligands are administered. VEGF (or VEGF-A) is
the ligand for VEGFRl and VEGFR2, VEGF-B is the ligand for VEGFR2, VEGF-C is the
ligand for VEGFR3, VEGFR4, and possibly VEGFR2, and VEGF-D is the Ugand for
VEGFR2 and VEGFR3. Optionally, the effect of more than one form of VEGF is inhibited.
An example of an antagonist to a VEGF receptor (flk-1) is the antibodies DClOl,

25 described in the Examples. Another is A.4.6. 1 and its chimeric and humanized form as
disclosed in L. G. Presta, Humanization of an Anti-vascular Endothelial Growth Factor
Monoclonal Antibody for the Therapy of Solid Tumors and Other Disorders. Cancer
Research^ 57, 4593-4599 (1997), which is hereby incorporated by reference. A preferred
VEGF antagonist is the mouse-human chimeric antibody IMC-lCl 1 which is a KDR

30 antagonist, and is disclosed in U.S. Application 09/240,736, which is hereby incorporated by
reference. The encoding nucleotide sequences and deduced amino acid sequences of the Vh
and Vl domains are shown in Figure 1 .

The chemotherapeutic agent of the present invention functions, in combination with

wo 01/54723

PCT/USOl/02839

the anti-angiogenic molecule, to cause a cytotoxic effect on the vascular endothelial cells
involved in angiogenesis. A number of chemotherapeutic agents have been identified as
having anti-angiogenic activity and are suitable for use in the practice of the present
invention. Examples include, but are not limited to, taxanes, including but not limited to
5 paclitaxel and docetaxel, camptothecin analogues, including but not limited to iranotecan and
topotecan, platinum analogues including but not limited to cisplatin and carboplatin, 5FU,
and vinca alkaloids, including but not limited to vinblastine, vincristine, vindesine and
vinorelbine.

The present invention provides a low dose application of a chemotherapeutic agent

10 administered in combination with an anti-angiogenic molecule in an amount and frequency
that, in combination, provides effective therapy without significant side-effects. Effective
therapy is therapy that provides regression or arrest of the angiogenic dependant condition.
An effective amount of anti-angiogenic molecule and chemotherapeutic agent is an amount of
each, that in combination controls (causes regression or arrest) the condition being treated

15 without producing significant chemotherapy induced toxicity. The meaning of significant
toxicity is well known to one of ordinary skill in the art, and includes toxicities that
cumulatively or acutely effect a patient's quality of life and/or limit the amount of
chemotherapeutic agent than can be admiivistered.

Examples of chemotherapy induced toxicity that can be minimized or prevented by

20 the present invention include, but are not limited to. myelosuppression, neurotoxicity,

cardiotoxicity, alopecia, nausea and vomiting, nephrotoxicity, and gastrointestinal toxicity.
The low dose administration of a chemotherapeutic agent without significant toxicity permits
prolonged treatment if desired. Additionally, the low dose manner of chemotherapy
administration in the present invention can overcome the problem of the development of

25 chemotherapeutic drug resistance by the patient's tumor cells that occurs with current

chemotherapeutic regimens which consist of higher doses of drug administered intermittently
with longer time intervals between treatment. The present invention delays, reduces, or even
circumvents the problem of acquired drug resistance by targeting the genetically stable
endothelial cells of newly formed tumor blood vessels, rather than genetically unstable tumor

30 cells which are prone to mutate and develop resistance. Encompassed within the scope of the
present invention is the administration of amounts of chemotherapy that are insufficient to
have a cytotoxic effect on tumor cells yet have anti-angiogenic properties as a result of the
drug's effect on vascular endothelial cells.

wo 01/54723

PCT/USOl/02839

The low-dose administi ation of chemotherapeutic agents, to achieve therapeutic
effects without significant toxicity (side effects) is readily possible by the practice of the
present invention. Applying standard methods of defining optimal dosage levels and
schedules to the teachings of the present invention, one of ordinary skill in the art readily can
5 determine a more or most desirable low-dose regimen for a selected chemotherapeutic agent
when used in combination with an anti-angiogenic molecule, as detailed in the present
application. A low-dose regimen will administer the chemotherapy at frequent intervals or
continually, at less than about 50% of the maximum tolerated dose (MTD), more preferably
less than about 45% of the MTD, more preferably less than about 40% of the MTD, more

10 preferably less than about 35% of the MTD, more preferably less than about 30% of the
MTD, more preferably at less than about 25% of the MTD, more preferably at less than
about 20% of the MTD, more preferably at less than about 10% of the MTD more
preferably less than about 5% of the MTD, and most preferably at less than about 2% of the
MTD, although the preferred dose depends on the particular chemotherapy. In any event, the

15 preferred dose will be a dose effective to inhibit or prevent progression of the angiogenic

dependent condition, when administered in combination with the anti-angiogenic molecule of
the present invention, while minimizing or preventing the development of significant
chemotherapy related toxicity. Optionally :1 . dose of chemotherapy will be effective to
inhibit or prevent progression of the angiogenic dependent condition even when administered

20 alone, although it is not intended that it be administered in this manner. Optionally the dose
of chemotherapy will be one which is sufficiently low that it does not exert a direct cytotoxic
effect on tumor cells, yet has an antitumor effect mediated by its anti-angiogenic properties.

Optionally, the low-dose regimen of the present invention will administer the
chemotherapeutic agent at a dose intensity of less than about 20% of the dose intensity used

25 when the chemotherapeutic agent is administered as part of a conventional chemotherapeutic
regimen (i.e. administered at connventional dosages and frequencies without an anti-
angiogenic molecule or other treatment modality) used to treat a particular neoplasm. The
dose intensity of the chemotherapeutic agent used in a conventional regimen can be readily
determined by one of ordinary skill in the art. By way of example, various regimens are

30 disclosed in V.T. Devita et al., Cancer: Principles & Practice of Oncology^ 5th edition,
Lippencott Williams and Wilkins. (1997) More preferably the present invention will
administer the chemotherapeutic agent at a dose intensity of less than about 1 0% of that used
when the chemotherapeutic agent is administered as part of a conventional chemotherapeutic

wo 01/54723

PCT/USOl/02839

regimen used to treat a particular neoplasm, and most preferably at a dose intensity of less
than about 5% of that used when the chernotherapeutic agent is administered as part of a
conventional chemotherapeutic regimen used to treat a particular neoplasm.

In the prior art, chemotherapy is usually given intermittently, commonly in the form
5 of a bolus infusion or an infusion lasting from about 20 minutes to about three hours, at about
the maximum tolerated dose (MTD) with long rest periods (e.g., 3 weeks) between successive
drug exposures. It has been suggested that these rest periods provide the endothelial cell
compartment of a tumor an opportunity to repair some of the damage inflicted by the
chemotherapy (T. Browder, et al., Antiangiogenic Scheduling of Chemotherapy Improves

1 0 Efficacy Against Experimental Drug- Resistant Cancer. Cancer Res. (In press) 1 999).

Administering lower doses of a chemotherapeutic drug more frequently such as weekly, more
preferably several times a week or continuously, enables circumvention of many problems
associated with standard chemotherapeutic doses. This anti-angiogenic scheduling of
chemotherapy optimizes anti-vascular effects. An added benefit is that administration of

15 chemotherapy in this manner can result in the increased sensitivity of the tumor cells to

chemotherapy. For example, a sub-line of the Lewis Lung Carcinoma, previously selected in
vivo for acquired resistance to the MTD of cyclophosphamide, is rendered sensitive again to
the drug in vivo by employing continuous \o\\' dose ir ;^apy of the same drug. The inclusion
of the anti-angiogenic molecule of the present invention provides substantial and

20 unexpectedly better results.

The invention provides low-dose administration of chemotherapy administered at
short intervals, preferably more frequently than every three weeks, more preferably more
frequently than weekly. Most preferably it is administered from about every 4 to about every
6 hours, to about daily to weekly. Optionally it is administered continuously. The preferred

25 time interval between administration of successive doses of chemotherapeutic agent is that
amount of time that is of sufficiently short duration that the blood levels of the
chemotherapeutic agent (or its active metabolite) will remain at about a concentration
sufficient to exert an anti-angiogenic effect for substantially the duration of treatment.
Preferably, such a blood level will be maintained for at least about 20% of the time between

30 doses, more preferably for at least about 30% of the time between doses more preferably for
at least about 50% of the time between doses, most preferably for at least about 70% of the
time between doses. Therapy is continued for a period of time from about 10 days to about 6
months, or as determined by one of skill in the art. Optionally, treatment will continue

wo 01/54723

PCT/USOl/02839

chronically for a period longer than six months for as long as is needed. The present invention
reduces host toxicity, allows for longer term administration of the chemotherapeutic agent in
diseases or pathological conditions requiring it, and does not sacrifice, and perhaps even
improves, anti-tumor efficacy. Optionally, increased efficacy will permit the use of shorter
5 durations of therapy for selected angiogenic dependent conditions.

The anti-angiogenic molecule is preferably administered in dosages and dose
fi-equencies sufficient to substantially saturate the selected target receptor or ligand.
Substantial saturation is saturation of at least about 50% of targeted receptors. A more
preferred level of saturation is at least about 80%, and a most preferred level of saturation is
10 about 100%. Optionally, the anti-angiogenic molecule is administered at a dose and

frequency sufficiently short to maintain a blood level sufficient to saturate the targeted
survival factor for at least about 50% of the time between doses, more preferably at least
about 70% of the time and most preferably at least about 90% of the time interval between
doses. Using the concentrations required to achieve receptor saturation or ligand
15 neutralization in vitro, and by analysis of serum concentrations of anti-angiogenic molecule
in vivo, both the appropriate dose and schedule can be determined readily by one of skill in
the art.

A preferred embodiment of the present invention c omprises the administration of the
antibody IMC-lCl 1, a KDR receptor antagonist with a c lemotherapeutic agent. A preferred

20 dose of IMC-lCl 1, is an amount that is sufficient to adequately saturate the targeted

receptors or ligand. In in vitro experiments, 50% saturation of VEGF receptors was obtained
as an IMC-lCl 1 concentration of 0.2 |ig/ml, and 100% at a concentration of 3 (ig/ml. A
preferred level of saturation is about at least 50%, a more preferred level is about at least
80%, and a most preferred level is about 1 00% saturation. For therapy, a preferred dose

25 regimen of IMC-lCl 1 is from about 5 mg/m- to about 700 mg/m-, more preferably from
about 7.5 mg/m' to about 225 mg/m-, administered about twice per week.

Another preferred embodiment of the invention combines IMC-lCl 1 in the doses
described above with vinblastine, administered in a low dose regimen, at a dose from about
0.5 mg /nr to about 3 mg/m- from about every 3 days to about every 7 days. Optionally, a

30 suitable chemotherapeutic agent other than vinblastine is administered in a dosage and

frequency that is of substantially equivalent efficacy to vinblastine (in the combination) at a
dose from about 0.5 mg /m- to about 3 mg/m- from about every 3 days to about every 7 days.
In other embodiments of the present invention, doses of an anti-angiogenic molecule

wo 01/54723

PCT/USOl/02839

in amounts and dosing frequencies sufficient to provide levels of receptor or ligand saturation
equivalent to that of IMC-lCl 1 in the doses about are combined with a chemotherapeutic
agent in a dose and frequency equivalent to that of vinblastine above, and therapy is carried
out for as long as is needed. An equivalent dose is one that, in the combination, is
5 substantially as effective in arresting or inhibiting the angiogenic dependent condition, while
being substantially as effective in minimizing or preventing significant chemotherapy
induced toxicity. In one preferred embodiment of the present invention, an equivalent dose of
another chemotherapeutic agent is determined using data derived from an animal model, an
example of which is included herein, utilizing a chemotherapy-resistant cell line so that any

10 observed antitumor effect is due to an effect on the vascular endothelium. A preferred dose of
vinblastine in a mouse is from about 1 mg/m^ to about 2 mg/m^ more preferably about 1.5
mg/m^ administered every three days. The MTD of this drug in mice is approximately 4-5
times that of a human, and a preferred dose is 1/16 - 1/20 of the MTD in mice. A preferred
dose of DC 101 in a mouse is about 800 \ig administered intraperitoneally every three days.

15 The use of DC 101 and vinblastine showed a therapeutic effect upon neuroblastoma cell lines
grown as xenografts in SCID mice. (L. Witte, L, et al.. Monoclonal antibodies targeting the
VEGF receptor-2 (flkl/KDR) as an anti-angiogenic therapeutic slvaXegy. Cancer Metastasis
Rev. 1 7: 1 55-161. (1998); Prewitt, 1999). In yet another preferred embodiment of the present
invention, low-dose vinblastine is administered every 3 days in combination with IMC- 1 CI 1

20 (plCll).

The anti-angiogenic molecule and chemotherapeutic agent of the present invention are
administered together or separately. Routes of administration include but are not limited to
oral, sublingual, and parenteral, including intravenously, subcutaneously, transcutaneously,
intraperitoneally, intrapleurally, and intrathecally. Optionally the molecule and agent are

25 formulated into a pharmaceutical preparation for administration via the desired route. The
agent and molecule are administered via the same route or via different routes

In one aspect of the present invention, there is provided a kit comprising an anti-
angiogenic molecule and a chemotherapeutic agent to be administered to a mammal in an
amount effective to produce a regression or arrest of an angiogenic dependent condition while

30 minimizing or preventing significant toxicity of the chemotherapeutic agent. Such a kit

optionally comprises an anti-angiogenic molecule and a chemotherapeutic agent in one or
more than one containers for administration at about the same time points or at different
times. Optionally, the anti-angiogenic molecule is administered intermittently and the

wo 01/54723

PCT/USOl/02839

chemotherapeutic agent is adnr inistered continuously or in a manner that permits the
maintenance of a suitable bloo J concentration. It is an aspect of the present invention that
such treatment optionally is administered for a prolonged period or chronically, without
substantial chemotherapy induced toxicity. Routes of administration include but are not
5 limited to oral and parenteral, including but not limited to intravenous, subcutaneous,

percutaneous, intrathecal and intraperitoneal. Patients that may be treated with the methods
and compositions of the present invention include any patients with an angiogenic dependent
disease.

The angiogenic dependent diseases encompassed by the scope of the present invention

10 include, but are not limited to neoplasms, collegen vascular diseases or autoimmune diseases.
All neoplasms are suitable for treatment with the present invention, however preferred
neoplasms are solid tumors. More preferred are breast carcinoma, lung carcinoma, prostate
carcinoma, colon carcinoma, prostate carcinoma, ovarian carcinoma, neuroblastoma, central
nervous system tumor, neuroblastoma, glioblastoma multiforme or melanoma, and a

15 preferred mammal to receive treatment is a human.

Antibodies used in this invention may be produced in a prokaryotic or eukaryotic cell.
Techniques for the creation of and production of such antibodies, or portions thereof are well
know in the field and are within the knowledge of one of ordinary skill in the art. Techniques
used for preparation of monoclonal antibodies, include but are not limited to, the hybridoma

20 technique (Kohler & Milstein, Nature. 256:495-497 (1975)), the trioma technique, the human
B-cell hybridoma technique (Kozbor et al., Immunology Today 4:72, (1983)), and the EBV-
hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, In
Monoclonal Antibodies and Cancer Therapy^ Alan R. Liss, Inc., pp. 77-96).

DNA encoding chimerized antibodies may be prepared by recombining DNA

25 substantially or exclusively encoding human constant regions and DNA encoding variable
regions derived substantially or exclusively from the sequence of the variable region of a
mammal other than a human. DNA encoding humanized antibodies may be prepared by
recombining DNA encoding constant regions and variable regions, other than the CDRs,
derived substantially or exclusively from the corresponding human antibody regions and

30 DNA encoding CDRs derived substantially or exclusively from a mammal other than a
human.

The DNA deletions and recombinations of the present invention may be carried out by
known methods, such as those described in PCT applications WO 93/21319, WO 89/09622,

wo 01/54723

PCT/USOl/02839

European Patent applications 239,400, 338,745 and 332,424 and/or other standard
recombinant DNA techniques. Conventional methods, such as those employed in the
construction of vectors and piasmids, the insertion of genes encoding polypeptides into such
vectors and piasmids, or the introduction of piasmids into host cells, are well known to those
5 of ordinary skill in the art and are described in numerous publications including Sambrook, J.,
Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edition.
Cold Spring Harbor Laboratory Press, and in Ausubel et al. (Eds) Current Protocols in
Molecular Biology, Green Publishing Associates/ Wiley-Interscience, New York (1990).

The invention also includes functional equivalents of the antibodies described in this
10 specification. Functional equivalents have binding characteristics comparable to those of the
antibodies, and include, for example, chimerized, humanized and single chain antibodies as
well as fragments thereof. Methods of producing such functional equivalents are disclosed in
PCX Application No. WO 93/21319, European Patent Application No. EPO 239,400; PCT
Application WO 89/09622; European Patent Application No. EP338,745; and European
1 5 Patent Application EPO 332,424.

The present invention also includes chimeric, single chain, and humanized antibodies,
as well as Fab fragments, or the product of an Fab expression library. The antibodies of the
invention can prepared by conventional methods which are well know in the art.

Techniques described for the production of single chain antibodies (U.S. Pat. No.
20 4,946,778, incorporated herein by reference) are adapted to produce single chain antibodies to
immunogenic polypeptide products of this invention.

According to another embodiment of the invention, the antibodies of the invention can
be prepared by recombinant DNA techniques by cloning and expressing all or part of a
known antibody. Using such techniques, which are known in the art, a chimeric or
25 humanized version of non-human antibodies can be prepared- For example, a chimeric

or humanized version of monoclonal antibody can be readily prepared by cloning the gene
encoding this antibody in to an appropriate expression vector. Useful in this regard are the
nucleic acids which encodes an amino acid sequence wherein the amino acid sequence
comprises the variable region, hypervariable region, or both of a monoclonal antibody that
30 specifically binds to a vascular endothelial survival factor.

More particularly, the present invention also includes recombinant constructs
comprising one or more of the sequences as broadly described above. The constructs
comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention

wo 01/54723

PCTAJSOl/02839

has been inserted, in a forward or reverse orientation. In a preferred embodiment of this
embodiment, the construct further comprises regulatory sequences, including, for example, a
promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters
are known to those of skill in the art, and are commercially available. The following vectors
5 are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pbs, pDlO,
phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16a, pNHlSA, pNH46A
(Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic:
pWLNEO, pSVZCAT, pOG44, pXTL pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL
(Pharmacia). However, any other plasmid or vector may be used as long as they are replicable

1 0 and viable in the host.

The constructs in host cells are used in a conventional manner to produce the gene
product encoded by the recombinant sequence. Appropriate cloning and expression vectors
for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al.. Molecular
Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989).

1 5 According to another aspect of the invention, transgenic mammals are provided that

express humanized antibodies to immunogenic products of this invention. Novel transgenic
mammalian hosts, other than primates, particularly other than human, are provided, where the
host is capable of mounting an immune response to an immunogen, where the response
produces antibodies having primate, particularly human, constant and/or variable regions or

20 such other effector peptide sequences of interest.

The hosts are characterized by being capable of producing xenogenic or modified
antibodies as a result of substitution and/or inactivation of the endogenous immunoglobulin
subunit encoding loci. The modifications retain at least a portion of the constant region which
provides for assembly of the variable region binding site bonded at the C-terminus to a

25 functional peptide. The functional peptide takes many forms or conformations and serves, for
example, as an enzyme, growth factor, binding protein, ligand, cytokine, effector protein,
chelating proteins, etc. The antibodies are any isotype, i.e., IgA, IgD, IgE, IgG, IgM or
subtypes within the isotype.

Transgenic hosts include murine, lagomorpha, ovine, porcine, equine, canine, feline,

30 and the like. For the most part, mice have been used for the production of B-lymphocytes. It

should be understood that other animals may be readily substituted for the mice, following

the same procedures.

Humanized and chimeric antibodies are prepared according to the following

wo 01/54723

PCT/USOl/02839

strategies. In one strategy, the human heavy and light chain immunoglobulin gene complexes
are introduced into the mouse germ line and in a separate step the corresponding mouse genes
are rendered non-functional. Polynucleotides encoding human heavy and light chain are
reconstructed in an appropriate eukaryotic or prokaryotic microorganism and the resulting
5 polynucleotide fragments are then introduced into pronuclei of fertilized mouse oocytes or

embryonic stem cells. Inactivation of the endogenous mouse immunoglobulin loci is achieved
by targeted disruption of the appropriate loci by homologous recombination in mouse
embryonic stem cells. In each case chimeric animals are generated which are derived in part
from the modified embryonic stem cells and are capable of transmitting the genetic
10 modifications through the germ line. The mating of mouse having a human immunoglobulin
loci to mouse having an inactivated immunoglobulin loci yields animals that produce purely
human antibody.

In another strategy, fragments of the human heavy and light chain immunoglobulin
loci are used to directly replace the corresponding mouse loci by homologous recombination

15 in mouse embryonic stem cells. This is followed by the generation of chimeric transgenic
animals. The resulting human antibodies are isolated, for example, from other proteins by
using an affinity column, having an Fc binding moiety, such as protein A, or the like.

The organi::ai:on, relative location of exons encoding individual domains, and
location of splice sites and transcriptional elements in a number of animals are known by

20 those of ordinary skill in the art. In human, for example, the immunoglobulin heavy chain
locus is located on chromosome 14. In the 5'-3' direction of transcription, the locus
comprises a large cluster of variable region genes (VH), the diversity (D) region genes,
followed by the joining (JH) region genes and the constant (CH) gene cluster. The size of the
locus is estimated to be about 2,500 kilobases (kb). During B-cell development,

25 discontinuous gene segments from the germ line Ig H locus are juxtaposed by means of a
physical rearrangement of the DNA.

Production of a functional heavy chain immunoglobuline polypeptide requires three
discontinuous DNA segments, from the VH, D, and JH regions, to be joined in a specific
sequential fashion generating the functional units. Once these units are formed specific heavy

30 chains are produced following transcription of the immunoglobuline locus. There are two
loci for immunoglobuline light (Ig L)chains, the kappa locus on human chromosome 2 and
the lambda locus on human chromosome 22. The structure of the Ig L loci is similar to that
of the Ig H locus, except that the D region is not present.

wo 01/54723

PCT/USOl/02839

The entire V region, or various fragments of the V region is used to produce a broad
spectrum of high affinity antibodies. For example, a subset of the known V region genes of
the human heavy and light chain Ig loci (Herman et al., EMBO J. 7: 727-738 (1988)) is used
to produce transgenic hosts, which transgeijic host are capable of mounting a strong immune
5 response and provide high affinity antibodies.

Antibodies or antibody analog producing B-cells from the transgenic host are used,
for example, for fusion to a mouse myeloid cell to produce hybridomas or immortalized by
other conventional process, i.e., transfection with oncogenes. These inmiortalized cells are
then grown, for example, in continuous culture or introduced into the peritoneum of a
10 compatible host for production of ascites.

As discussed above, present invention also provides for the production of polyclonal
human anti-serum or human monoclonal antibodies or antibody analogs provided they retain
the activities of the antibodies of the invention. Epitope binding component of the present
invention refers to proteins consisting of one or more polypeptides substantially encoded by
15 genes of the immunoglobulin superfamily (i.e.. The Immunoglobulin Gene Superfamily,
Williams & Barclay In: Immunoglobulin Genes, Honjo, Alt, and Rabbitts, eds., (1989)
incorporated herein by reference). For example, an epitope binding component comprises
part or all of a heavy chain, part or all of a light chain, or both. However, an cpitupe binding
component must contain a sufficient portion of an immunoglobulin superfamily gene product
20 to retain the ability to bind to a specific target, or epitope.

Included within the scope of this invention is bispecific antibodies that are formed by
joining two epitope binding components that have different binding specificities.

In general, modifications of the genes encoding the desired epitope binding
components are readily accomplished by a variety of well-known techniques, such as site-
25 directed mutagenesis (see, Gillman & Smith, Gene 8:81-97 (1979) and Roberts, et. al.. Nature
328:731-734 (1987), both of which are incorporated herein by reference).

In preferred embodiments of the invention, the epitope binding component of the
antibody of this invention is encoded by immunoglobulin genes that are "chimeric" or
"humanized" (see, generally. Queen (1991) Nature 351:501, which is incorporated herein by
30 reference). Once expressed, VE-cadherin antibodies, epitope binding components, their

dimers, or individual light and heavy chains are purified according to standard procedures of
the art, for example, ammonium sulfate precipitation, fraction column chromatography, gel
electrophoresis and the like (see, generally. Scopes, Protein Purification, Springer-Verlag,

wo 01/54723

PCT/USOl/02839

N.Y. (1982)). Once purified, partially or to homogeneity as desired, the antibodies and
fragments thereof are then used ,for example, therapeutically, diagnostically, in drug
screening techniques, or in developing and performing assay procedures, such as
immunofluorescent staining, and the like.
5 The examples which follow are set forth to aid in understanding the invention, but are

not intended to, and should not be construed as, limiting the scope of the invention in any
manner.

wo 01/54723

PCT/USOl/02839

Examples

Cells and culture conditions: Neuroblastoma cell lines SK-N-MC, SK-N-AS were
obtained from American Type Culture Collection (ATCC) and expanded as a monolayer
culture by serial passage on tissue culture plates (Nunc, Denmark) in DMEM, 5% fetal
bovine serum (Gibco, Grand Island, NY, USA). Human umbilical vein endothelial cells
(HUVEC) (Clonetics, San Diego, CA) were expanded on 1% gelatin-coated tissue culture
plates in MCDBI31 culture medium (JRH Biosciences, Lenexa, KS, USA) supplemented
with 5 ng/ml bFGF (R&D, Minneapolis, MN), 10 units/ml heparin (Wyeth-Ayerst Canada),
10 ng/ml EGF (UBI, Lake Placid, NY) and 10% fetal bovine serum.

In vitro determination of drug sensitivity; Three thousand cells in 200 jil growth
media per well were plated in 96-well flat bottom tissue cuhure plates (Nunc, Denmark) and
incubated at 37 °C, 5% CO2 for 24 hours prior to initiation of treatment. The cells were then
washed with PBS and treated with 1-500 ng/ml vinblastine sulphate (Calbiochem, La Jolla,
Ca) for 24 hours, in groups of eight wells per dose. The cells were then pulsed for 6 hrs with
2 |iCi/well of methyl-^H-thymidine (Amersham Life Science, Buckinghamshire, England).
The plates were frozen, thawed and the DNA harvested onto a filtermat using a Titertek Cell
Harvester. Incorporated radioactivity was measured on Wallac 1205 BetaPlate Scintillation
Counter (Wallac Oy, Finland) and proliferation was expressed as a percentage of ^H-
thymidine in treated cells vs. that in controls.

In vivo tumor growth assessment: SK-N-MC, cells were harvested using 1% Trypsin
EDTA (GibcoBRL, Gaithesburg, MD), and single cell suspension of 2 x 10^ cells in 0.2 ml of
growth media was injected subcutaneousiy into the flanks of 4-6 week old CB-1 7 SCID mice
(Charles River, St-Constant, Quebec). Approximately 3 weeks later, most tumors had grown
to — 0.75 cm^, and mice were randomized into groups of 5 animals. Two independent
experiments were performed, each totaling 20 animals in 4 groups. The treatment was as
follows:

Group I (Control) - 0.4 ml of PBS (DC 101 vehicle) i.p. every three days and 0.15 ml
injectable saline (vinblastine vehicle) i.p. every three days.

Group II - 0.4 ml of 2 mg/ml DC 101 antibody (800 |ag/mouse) (24) every three days
and 0.15 ml of injectable saline i.p. every three days

wo 01/54723

PCT/USOl/02839

Group III - vinblastine sulfate 0.75 mg/m^ i.p. bolus at the start of therapy, followed
by 1 mg/mVday via subcutaneous Alzet osmotic pumps (Alza Corp,Palo Alto, CA) for 3
weeks, followed by maintenance therapy with 0. 1 5 ml of 0.067 mg/ml vinblastine sulfate (1 .5
mg/m^) i.p. every three days, and 0.4 ml of PBS i.p. every three days
5 Group IV - combination of DC 1 01 and vinblastine at doses identical to the single

agent groups.

The body weight, tumor size and general clinical status of the animals were recorded
every 2-3 days. Perpendicular tumor diameters were measured using a vernier scale caliper
and tumor volume was estimated using the formula for ellipsoid: (width-^ x length)/2. Growth
10 curves were statistically analyzed using repeated measures ANOVA. All animal care was in
accordance with institutional guidelines. As required by institutional guidelines, the mice
were sacrificed when tumor size reached 1 .5 cm^ or 7.5-10% of their body weight.

Histology: All tumors were excised, fixed in 10% (v/v) formalin and processed for
15 immunohistochemical analysis. To obtain adequate tissue for the combination treatment

group, two mice were sacrificed at 7.5 weeks of treatment. Paraffin blocks were cut to 5 \im
sections and stained with haematoxylin/eosin for morphology evaluation and with Apoptosis
Detection System (Promega, Madison, Wisconsin) for assessment of programmed cell death.

20 Relative tumor vascularity assessed by an FITC-Dextran perfusion assay: The

method was designed to assess the relative functionality of the tumor vasculature. 2x10^ SK-
N-AS neuroblastoma cells were injected into the flanks of CB-17 SCID mice. Tumors were
allowed to grow to approximately 0.75 cm^ at which point tumor bearing mice were then
treated with 1 mg/m~ vinblastine i.p. every three days, 800 ^ig DC 101 i.p. every three days,

25 combination of the two agents or saline as a control. At 14 days, when divergence in tumor
growth between the treatment groups was clearly evident, 0.2 ml of 25 mg/ml FITC-Dextran
in PBS (^igma, St. Louis, MO) was injected systemically into the lateral tail vein of each
mouse and allowed to circulate for 20-30 minutes. Mice were then sacrificed by cervical
dislocation and blood samples were collected into heparinized tubes by cardiac puncture for

30 assessment of systemic fluorescein levels. Tumors were resected from the surrounding
connective tissue being careful to avoid spillage of intra-vascular contents, weighed and
placed into tubes containing 1:10 dispase (Collaborative Research, Two Oaks, Bedford, MA).
To normalize for dilution caused by the difference in tumor sizes, 1 ml of 1 : 10 dispase was

wo 01/54723

PCT/USO 1/02839

added per 0.5 g of tissue. Tumors were incubated in a dark 37 °C shaker ove. night. The tissue
was homogenized, centrifuged at 5000 rpm for 1 0 minutes, and the supernatant was collected
and stored in the dark until further analysis. Blood samples were centrifuged immediately
following collection, plasma separated and protected fi*om light at 4°C until analysis.
Fluorescence readings were obtained on a FL600 Fluorescence Plate Reader (Bio-tek
Instruments Inc., Winooski, Vermont, USA), from a standard curve created by serial dilution
of the FITC-dextran used for injection. The ratio of tumor fluorescence: plasma fluorescence
was assumed to be reflective of the degree of tumor perfusion.

In vivo angiogenesis assessment by the Matrigel plug assay (5,25): Matrigel
(Collaborative Biomedical Products, Bedford, MA) stored at -20 °C, was thawed at 4°C
overnight and mixed with 500 ng/ml bFGF. 0.5 ml of this mixture was then injected
subcutaneously into the shaved flanks of twenty 6-8 week old female Balb/cJ mice (Jackson
Labs, Bar Harbor, Maine). Five mice, used as negative controls, were injected with Matrigel
alone. Three days later, treatment mice were randomized into four groups as follows:

Group 1 - saline i.p..

Group II - 800 jag DCIOl i.p.

Group III - 1 mg/m- virHlastine i.p.

Group IV - combination therapy.
All 25 mice were treated on day 4 and 7 and sacrificed on day 10. Blood samples were
collected into heparinized tubes by cardiac puncture, centrifuged immediately following their
collection, plasma separated and protected from light at 4°C. The Matrigel plugs were
resected from surrounding connective tissues, placed into tubes containing 1 ml of 1 : 1 0
dispase and incubated in the dark in a 37 °C shaker overnight. The following day, the plugs
were homogenized, centrifuged at 5000 rpm for 1 0 minutes and supernatant saved in the dark
for analysis of fluorescence. Fluorescence readings were obtained on FL600 Fluorescence
Plate Reader using a standard curve created by serial dilution of FITC-dextran used for
injection. Angiogenic response was expressed as a ratio of Matrigel plug fluorescence:
plasma fluorescence.

In vitro determination of differential drug sensitivity: Prior to undertaking our \n vivo
experiments we established a dose of vinblastine, at which significant toxicity of endothelial,
but not tumor, cells was observed. To do so, we optimized growth conditions to achieve

wo 01/54723

PCT/USOl/02839

comparable levels of mitotic activity in tw^o human neuroblastoma cell lines (SK-NM-C and
SK-N-AS) and HUVEC. All three cell lines were grown in DMEM with 10% bovine serum,
but the HUVEC were grown on gelatinized plates and in the presence of additional growth
factors (bFGF and EGF). The untreated controls show similar levels of ^H-Thymidine
5 incorporation for all three cell lines thus eliminating the concern that the differences in

proliferation may be inherent. At the higher concentrations of vinblastine used (e.g. 100-400
ng/ml) all three cell populations were strongly inhibited, especially HUVEC, In striking
contrast, at the lowest concentrations (e.g. 0.78 ng/ml) vinblastine retained almost the same
degree of inhibitory activity against HUVEC, whereas anti-proliferative activity against two
10 tumor cell lines was not. The source of this differential sensitivity is not clear, but it should
be noted that at least one of the tumor cell lines, SK-N-MC, is positive for multidrug
resistance-associated protein (MRP). These in vitro findings suggest that the lowering of the
usual maximum tolerated dose (MTD) used in the clinic may allow retention of good
vinblastine activity against dividing endothelial cells present in tumors.

In vivo tumor growth assessment: Building on this in vitro difference in sensitivity to
vinblastine, we went on to evaluate lower doses of * inblastine in an in vivo modeL using an
increased dose frequency to maximize the endothe .:! injury. Xenografts of either SK-N-MC
neuroepithelioma or .^iN.~:\-AS neuroblastoma cell lines were implanted subcutaneously in

20 the flanks of 4-6 week old. CB-I7 SCID mice and grown to - 0.75 cm^ before initiation of
treatment. The first treatment group, treated with DC 1 01 , an anti- Flkl receptor antibody
shown previously to inhibit growth of different kinds of human xenografts in mice and in
mouse tumor models (5), showed an anticipated effectiveness in inhibiting tumor growth, but,
its effect was not sustained. The findings in the second treatment group (vinblastine alone),

25 were even more surprising. This agent, traditionally thought to act by inhibiting tumor cell
proliferation through inhibition of tubulin assembly, produced significant, albeit not
sustained, regression of tumor growth even though used at subclinical low-dose,. This growth
delay in the vinblastine group was further potentiated with the simultaneous treatment with
the anti-flk-1 antibody, DClOl . The combination treatment induced an initial response

30 comparable to the other treatment groups but then caused further, long term, tumor
regression. To date, the mice in combination therapy group have not manifested any
resistance to the treatment or recurrence of disease, despite almost seven months of
continuous treatment. The mice remain healthy, with almost no evidence of tumor, except for

wo 01/54723

PCT/USOl/02839

a small, barely palpable remnant in one of the mice.

Toxicity evaluation: Anti-vascular therapy would be expected to show minimal
toxicity in the post-natal stage of development. To evaluate this aspect of DC 1 0 1 /vinblastine
5 combination therapy, the health status of the mice was monitored. Weight was plotted at

regular intervals and considered a surrogate for evaluation of systemic well being, anorexia,
or failure to thrive. No significant differences in weights were seen between the four groups.
The weight cun^'" of the DC 101 group parallels very closely that of the control group. The
vinblastine group showed some weight gain retardation, but the differences never became

10 significantly different from controls. Similarly, the toxicity profile in the combination

treatment group was very similar to those in the single agent groups, with the exception of a
transient episode of weight loss associated with diarrhea. The episode lasted approximately
2-3 weeks and was unlikely to be due to the therapy as the mice recovered without
interruption of treatment.Other usual signs of drug toxicity in mice such as ruffled fur,

15 anorexia, cachexia, skin tenting (due to dehydration), skin ulcerations or toxic deaths, were
not seen at the doses used in our experiments. Diarrhea, a common sign of vinblastine
toxicity when doses of 10 mg/m- are used, was generally not observed, except for the above
mentioned episode.

20 Histopathologic analysis: To further elucidate the mechanisms involved in the tumor

regression following treatment with vinblastine, DClOl, or the combined therapy, tissue
histopathology assessment was undertaken. Cancer cells with high nuclear to cytoplasmic
ratio form cuffs around central vessels, and apoptotic cells characterized by pyknotic nuclei
and cytoplasmic blebbing, are only evident as a thin rim at the periphery of the cuffs. The

25 nuclei of these cells stain strongly for terminal deoxynucleotidyl transferase (TUNEL)

reactivity, as expected for cells undergoing apoptosis. Vinblastine alone or DC 101 treatment
alone both show an increase in the width of the apoptotic rims, suggesting the cells most
distal to the tumor vasculature are primarily affected, but a large percentage of viable tumor
cells still survive in the center of the cuff. In contrast, histology of the combined therapy

30 group, as would be predicted by the regression in tumor size in this treatment group at the
time of analysis, shows overwhelming loss of both cell viability and pre-existing tumor
architecture. There is a close similarity of the appearance of H/E and TUNEL stain.
Interestingly, we observed signs of endothelial cell toxicity in all of the treatment groups.

wo 01/54723

PCT/USOl/02839

Rather than a typical single layer of flattened endothelial cells surrounding the vascular
lumen in untreated group, we observed edema, and detachment from surrounding basement
membrane and leading to complete vascular wall disintegration and tumor cell death.

5 Tumor perfusion by assessment of intravascular fluorescence: To further explore the

possibility that tumor regression induced with treatment using DC 101 and vinblastine was
indeed due to the vascular injury, rather than a direct anti-tumor cell effect, we assessed
txzmor perfusion directly by using a FITC-Dextran fluorescence method. Mice carrying
established subcutaneous SK- N-AS human neuroblastoma xenografts (-0.75 cm^) were

10 randomized into four groups and treated systemically with either saline control, DClOl ,

vinblastine or combination therapy for 10 days. FITC-Dextran was injected into the lateral
tail vein and equilibrated throughout the vascular compartment. The majority of the blood-
borne dextran, because of its 150 kDa size, remains intravascular, and despite some
perivascular losses due to changes in vascular permeability and the possibility of interstitial

15 hemorrhages, the fluorescence is reflective of the overall volume of blood passing through the
tumor vasculature. Since our therapy is chronic in its nature, changes in intra- tumoral
vascular/blood volume are likely to represent structural changes rather than transient fluxes in
vascular permeability. By : e criteria DC 101 alone caused a 47 "'o decrease in tumor
perfusion, whereas vinblasu. o aione resulted in a 41% decrease, and the combination of the
20 two drugs resulted in 65% perfusion inhibition. Of interest is the appreciable difference in
gross vascularity in the corresponding tumor specimens.

Effects of chemotherapy treatments on in vivo angiogenesis: The direct assessment of
tumor vasculature does not provide any clues as to whether the apparent vascular inhibition

25 within the tumor is a primary cause or a secondary consequence of the tumor regression.

Evidence for the former would provide support for the hypothesis that low-dose vinblastine
treatment alone is potentially anti-angiogenic, and the extent of this anti-angiogenic effect
may be ftirther enhanced by concurrent treatment with DC 101 . Again, the ratio between
intra- and extra-vascular volume within the tumor could be also somewhat affected by

30 transient changes in vascular permeability. To address these questions, we repeated the same
fluorescence measurement using an in vivo Matrigel plug angiogenesis assay. Four treatment
groups were treated with an identical therapeutic regimen as in the tumor perfusion
experiment. The regression of vascularity in subcutaneously implanted Matrigel pellets was

wo 01/54723

PCTAJSOl/02839

quantitatively assessed by mea suring the fluorescence of circulating FITC-labeled dextran.
DClOl administration inhibited bFGF induced vascularization to 50% of the positive control
group, and vinblastine administration inhibited vascularization to 62,5% of the positive
control group. There was again an enhanced effect with combination therapy, which reduced
the Matrigel pellet fluorescence, and by inference vascularization to 29.2% of control, a level
only marginally different to the negative control (Matrigel not supplemented with growth
factors).

Thus, large (0.75 cm^) established human neuroblastoma xenografts could be induced
to completely regress with this combination strategy, whereas either agent alone caused only
partial and temporary regressions with relapses observed in all animals treated at between SO-
SO days after initiation of the individual therapy treatments. In striking contrast, a fully
regressed state could be induced and maintained for as long as the combination therapy was
maintained, which in our case was 200 days, in the absence of any significant toxicity, as
assessed by lack of weight loss. No myelosuppression has been observed.

The dose of vinblastine used in our experiments was in the range of 1 .5 mg/m^, every
3 days, which is approximately 3 times the MTD of this drug in humans, and 1/16 - 1/20 of
the MTD in mice, given the fact that the MTD of vinblastine in mice is 4-5 times higher than
in humans. Using the Matrigel plug a>sa> we demonstrated that continuous low dose
vinblastine administration can cause a direct anti-angiogenic effect in vivo. The combined
effect with DC 101 was significant.

wo 01/54723

PCT/USOl/02839

What is claimed is:

1. A method of treating or controlling an angiogenic dependent condition in a mammal
comprising:

administering an anti-angiogenic molecule and

a chemotherapeutic agent to the mammal, in amounts and frequencies effective, in
combination, to produce a regression or arrest of said condition while minimizing or
preventing significant toxicity of the chemotherapeutic agent.

2. The method of claim 1 , wherein the anti-angiogenic condition is selected from the
group consisting of a neoplasm, a collagen-vascular disease or an auto-immune
disease.

3. The method of claim 2, wherein the neoplasm is a solid tumor.

4. The method of claim 3, wherein the solid tumor is selected from the group consisting
of breast carcinoma, lung carcinoma, prostate carcinoma, colon carcinoma, prostate
carcinoma, ovarian carcinoma, neuroblastoma, central nervous system tumor,
neuroblastoma, glioblastoma multiforme or melanoma.

5. The method of claim K wherein the mammal is a human.

6. The method of claim 1 , wherein the anti-angiogenic molecule inhibits or blocks the
action of an vascular endothelium survival factor.

7. The method of claim 6, wherein the vascular endothelial survival factor is selected
from the group consisting of VEGF, VEGF receptor,avP3. avP3 receptor, Tie2/tek
ligand, Tie2/tek, endoglin ligand, endoglin, neuropilin ligand, neuropilin,
thrombospondin ligand, thrombospondin, PDGFa, PDGFa receptor, PDGFP, PDGFp
receptor, aFGF, aFGF receptor, bFGF, bFGF receptor, TGpp, TGPp receptor, EGF,
EGF receptor, angiostatin, angiostatin receptor, angiopoetin, angiopoeitin receptor,
PLGF, PLGF receptor, VPF, or VPF receptor.

8. The method of claim 6, wherein the vascular endothelial survival factor is a receptor.

wo 01/54723

PCT/USOl/02839

9. The method of claim 8, wherein the vascular endothelial survival factor is an
angiogenesis growth factor receptor.

10. The method of claim 9, wherein the angiogenesis growth factor receptor is a VEGF
receptor.

1 1 . The method of claim 10, wherein the VEGF receptor is selected from the group
consisting of flk-l/KDR receptor, or flt-4 receptor.

12. The method of claim 6, wherein the vascular endothelial survival factor is a ligand to
a receptor.

13. The method of claim 12, wherein the ligand is selected from the group consisting of
VEGF, VEGF-B, VEGF-C, or VEGF-D.

14. The method of claim 6, wherein the anti-angiogenic molecule is selected from the
group consisting of an antibody, antibody fragment, small molecule or peptide.

15. The method of claim 14, wherein the molecule is an antibody or fragment selected
from the group consisting of mouse, rat, rabbit, chimeric, humanized or human
antibody or fragment.

16. The method of claim 6, wherein the anti-angiogenic molecule is IMC-lCl 1.

17. The method of claim 16, wherein the IMC-lCl 1 is administered in a dose of from
about 5 mg/m- to about 700 mg/m- from about daily to about every 7 days.

1 8. The method of claim 1 7, wherein the IMC-1 C 1 1 is administered in a dose of from
about 7.5 mg/m- to about 225 mg/m-, about twice per week.

19. The method of claim 16, wherein the IMC-lCl 1 is administered at a dose and
frequency sufficient to substantially saturate the VEGF receptor.

wo 01/54723

PCT/USOl/02839

20. The method of claim 6, wherein the anti-angiogenic molecule is administered in a
dose and frequency sufficient to substantially saturate the target of the anti-angiogenic
molecule.

21 . The method of claim 1 , wherein the chemotherapeutic agent is selected from the
group consisting of vinca alkaloid, camptothecan, taxane, or platinum analogue.

22. The method of claim 21 , wherein the chemotherapeutic agent is selected from the
group consisting of vincristine, vinblastine, vinorelbine, vindesine, paclitaxel,
docetaxel, 5 FU, cisplatin, carboplatin, iranotecan, topotecan or cyclophosphamide.

23. The method of claim 22, wherein the chemotherapeutic agent is administered at less
than about 20% of the maximum tolerated dose.

24. The method of claim 23, wherein the chemotherapeutic agent is administered at less
than about 15% of the maximum tolerated dose.

25. The method of claim 24, wherein the chemotherapeutic agent is administered at less
than about 10% of the maximum tolerated dose.

26. The method of claim 25, wherein the chemotherapeutic agent is administered at less
than about 5% of the maximum tolerated dose.

27. The method of claim 26, wherein the chemotherapeutic agent is administered at less
than about 2% of the maximum tolerated dose.

28. The method of claim 28, wherein the chemotherapeutic agent is administered at a dose
intensity less than about 20% of the dose intensity of the chemotherapeutic agent
when used in a conventional chemotherapeutic regimen,

29. The method of claim 1 , wherein the chemotherapeutic agent is administered at a dose
intensity less than about 1 0% of the dose intensity of the chemotherapeutic agent

wo 01/54723

PCT/USOl/02839

when used in a conventi 3nal chemotherapeutic regimen.

30. The method of claim 29, v/herein the chemotherapeutic agent is administered at a dose
intensity less than about 5% of the dose intensity of the chemotherapeutic agent when
used in a conventional chemotherapeutic regimen.

3 1 . The method of claim 22, wherein the chemotherapeutic agent is vinblastine
administered in a dose from about 0.5 mg/m^ to about 3 mg/m^ from about once every
3 days to about once every 7 days.

32. The method of claim 1, wherein the chemotherapeutic agent is administered in a
dosage and frequency that is of substantially equivalent efficacy to vinblastine in a
dose from about 0.5 mg/m- to about 3 mg/m~ from about once every 3 days to about
once every 7 days.

33. The method of claim 1, wherein the chemotherapeutic agent is administered more
frequently than about once every three weeks.

34. The method of claim 33, wherein the chemotherapeutic agent is administered more
frequently than about every seven days.

35. A kit for treating an angiogenic dependent condition in a mammal comprising:
an anti-angiogenic molecule; and,

a chemotherapeutic agent, to be administered in amounts and frequencies effective, in
combination, to produce a regression or arrest of the condition while minimizing or
preventing significant toxicity of the chemotherapeutic agent, when administered in
combination.

36. The kit of claim 35, wherein the angiogenic dependent condition is selected from the
group consisting of neoplasm, collagen-vascular disease or autoimmime disease,

37. The kit of claim 36, wherein the neoplasm is a solid tumor.

wo 01/54723

PCT/USOl/02839

38. The kit of claim 37, wherein the solid tumor is selected from the group consisting of
breast carcinoma, Ivmg carcinoma, prostate carcinoma, colon carcinoma, prostate
carcinoma, ovarian carcinoma, neuroblastoma, central nervous system tumor,
neuroblastoma, glioblastoma multiforme or melanoma.

39. The kit of claim 35, wherein the mammal is a human.

40. The kit of claim 35, wherein the anti-angiogenic molecule inhibits or blocks the action
of a vascular endothelium survival factor.

41. The kit of claim 40, wherein the vascular endothelial survival factor is selected from
the group consisting of VEGF, VEGF receptor,avp3. cXyPs receptor, Tie2/tek ligand,
Tie2/tek, endoglin ligand, endoglin, neuropilin ligand, neuropilin, thrombospondin
ligand, thrombospondin, PDGFa, PDGFa receptor, PDGFp, PDGFp receptor, aFGF,
aFGF receptor, bFGF, bFGF receptor, TGFp, TGPP receptor, EGF, EGF receptor,
angiostatin, angiostatin receptor, angiopoetin, angiopoeitin receptor, PLGF, PLGF
receptor, VPF, or VPF receptor.

42. 1 le kit of claim 35, wherein the vascular endothelial surv ival factor is a receptor.

43. The kit of claim 42, wherein the vascular endothelial survival factor is an
angiogenesis growth factor receptor.

44. The kit of claim 43, wherein the angiogenesis growth factor receptor is a VEGF
receptor.

45- The kit of claim 44, wherein the VEGF receptor is selected from the group consisting
of flk- 1 /KDR receptor, or flt-4 receptor.

46. The kit of claim 40, wherein the vascular endothelial survival factor is a ligand for a
receptor.

47. The kit of claim 46, wherein the ligand is selected from the group consisting of

wo 01/54723

PCTAJSOl/02839

VEGF, VEGF-B, VEGF-C, or VEGF-D.

48. The kit of claim 40, wherein the anti-angiogenic molecule is selected from the group
consisting of an antibody, antibody fragment, small molecule or peptide.

49. The kit of claim 48, wherein the molecule is an antibody or fragment selected from
the group consisting of mouse, rat, rabbit, chimeric, humanized or human antibody
or fragn^'^nt.

50. The kit of claim 48, wherein the antibody is IMC- 1 CI 1 .

51. The kit of claim 50, wherein the IMC- 1 CI 1 is provided for administration in a dose of
from about 5 mg/nr to about 700 mg/m~ about every 1 day to about every 7 days.

52. The kit of claim 51, wherein the IMC-ICl 1 is provided for administration in a dose of
from about 7.5 mg/m- to about 225 mg/m-, about twice per week.

53. The kit of claim 50, wherein the IMC-lCl 1 is provided for administration at a dose
and frequency sufficient to substantially saturate the VEGF receptor.

54. The kit of claim 40, wherein the anti-angiogenic molecule is provided for
administration in a dose and frequency sufficient to substantially saturate the target of
the anti-angiogenic molecule.

55. The kit of claim 35, wherein the chemotherapeutic agent is selected from the group
consisting of a vinca alkaloid, a camptothecan, a taxane, or a platinum analogue.

56. The kit of claim 55, wherein the chemotherapeutic agent is selected from the group
consisting of vincristine, vinblastine, vinorelbine, vindesine, paclitaxel, docetaxel, 5
FU, cisplatin, carboplatin, iranotecan, topotecan or cyclophosphamide.

57. The kit of claim 35, wherein the chemotherapeutic agent is provided for
administration at less than about 20% of the maximum tolerated dose.

wo 01/54723

PCT/USOl/02839

58. The kit of claim 57, wherein the chemotherapeutic agent is provided for
administration at less than about 1 5% of the maximum tolerated dose.

59. The kit of claim 58, wherein the chemotherapeutic agent is provided for
administration at less than about 1 0% of the maximum tolerated dose.

60. The kit of claim 59, wherein the chemotherapeutic agent is provided for
administration at less than about 5% of the maximum tolerated dose.

61. The kit of claim 60, wherein the chemotherapeutic agent is provided for
administration at less than about 2% of the maximum tolerated dose.

62. The kit of claim 35, wherein the chemotherapeutic agent is provided to be
administered at a dose intensity less than about 20% of the dose intensity of the
chemotherapeutic agent when used in a conventional chemotherapeutic regimen.

63. The kit of claim 62. vherein the chemotherapeutic agent is provided to be
administered at a dose intensity less than about 10% of the dose intensity of the
chemotherapeutic agent when used in a conventional chemotherapeutic regimen.

64. The kit of claim 63, wherein the chemotherapeutic agent is provided to be
administered at a dose intensity less than about 5% of the dose intensity of the
chemotherapeutic agent when used in a conventional chemotherapeutic regimen.

65. The kit of claim 56, wherein the chemotherapeutic agent is vinblastine, provided for
administration in a dose from about 0.5 mg/m~ to about 3 mg/nr from about once
every 3 days to about once every 7 days.

66. The kit of claim 35, wherein the chemotherapeutic agent is provided for
administration at a dosage and frequency that is of substantially equivalent efficacy to
vinblastine is a dose from about 0.5 mg/nr to about 3 mg/m^from about once every 3
days to about once every 7 days.

wo 01/54723

PCT/USOl/02839

67. The kit of claim 35, wh*irein the chemotherapeutic agent is provided for
administration more frequently than about every three weeks,

5 68. The kit of claim 67, w^herein the chemotherapeutic agent is provided for

administration more frequently than about every seven days.

wo 01/54723

1/1

PCTAJSOl/02839

FIGURE 1

Hindi I I

GAACTT ATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACAT
MGWSCI IliFLVATATGVH
leader

TCACAGGTCAAGCTGCAGCAGTCTGGGGCAGAGCTTGTGGGGTCAGGGGCCTCAGTCAAA
SQVKLQQSGAELVGSGASVK
- > VH

TTGTCCTGCACAACTTCTGGCTTCAACATTAAAGACTTCTATATGCACTGGGTGAAGCAG
L S C T T S GFNIKDFYMH W V K Q

CDR-Hl

AGGCCTGAACAGGGCCTGGAGTGGATTGGATGGATTGATCCTGAGAATGGTGATTCTGAT
RPEQGLEWIG WIDPENGDSD

CDR-H2

TATGCCCCGAAGTTCCAGGGCAAGGCCACCATGACTGCAGACTCATCCTCCAACACAGCC

Y A P K F O G KATMTADSSSNTA

TACCTGCAGCTCAGCAGCCTGACATCTGAGGACACTGCCGTCTATTACTGTAATGCATAC
YLQLSSLTSEDTAVYYCNAY

TATGGTGACTACGAAGGCTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGAG

Y G D Y E G Y WGQGTTVTVSS

CDR-H3

BamHI
TGGATCC

Hindu I

AAGCTTATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACAT
MGWSCI ILFLVATATGVH
>- leader

TCAGACATCGAGCTCACTCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTC
SDIELTQSPAIMSASPGEKV
► VL

ACCATAACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGCACTGGTTCCAGCAGAAGCCA
T I T C SAS S SVS YMH W F Q Q K P

CDR-Ll

GGCACTTCTCCCAAACTCTGGATTTATAGCACATCCAACCTGGCTTCTGGAGTCCCTGCT
GTSPKLWIY S T S N L A S G V P A

CDR-L2

CGCTTCAGTGGCAGTGGATCTGGGACCTCTTACTCTCTCACAATCAGCCGAATGGAGGCT
RFSGSGSGTSYSLTISRMEA

GAAGATGCTGCCACTTATTACTGCCAGCAAAGGAGTAGTTACCCATTCACGTTCGGCTCG
EDAATYYC OORSSYPFT F G S

CDR-L3

BamHI

GGGAC CAAGCTGGAAATAAAACGTGAGT GGATCC
G T K L E I K

wo 01/54723

PCT/USOl/02839

SEQUENCE LISTING

<110> Kerbel, Robert

<120> Therapeutic Method for Reducing Angiogenesis

<130> Sequence Listings 1-16 for 11245-19

<140> Not yet as^^gned
<141> 2000-03-20

<150> US 60/178791

<160> 16

<170> Patentin Ver. 2.1

<210> 1
<211> 10
<212> PRT
<213> Mouse

<400> 1

Giy Phe Asn lie Lys Asp Phe Tyr Met His
1 5 10

<210> 2
<211> 17
<212> PRT
<213> Mouse

<400> 2

Trp lie Asp Pro Glu Asn Giy
1 5

Giy

AsD T/r Ala Pro Lys Phe Gin
10 15

<210> 3
<211> 8
<212> PRT
<213> Mouse

<400> 3

Tyr Tyr Giy Asp Tyr Glu Giy Tyr
1 5

<210> 4
<211> 10
<212> PRT
<213> Mouse

<400> 4

Ser Ala Ser Ser Ser Val Ser Tyr Met His
1 5 10

<210> 5
<211> 7
<212> PRT
<213> Mouse

wo 01/54723

PCT/USOl/02839

<400> 5

Ser Thr Ser Asn Leu Ala Ser
1 5

<210> 6
<211> 9
<212> PRT
<213> Mouse

<400> 6

Gin Gin Arg Ser Ser Tyr Pro Phe Thr
1 5

<210> 7
<211> 117
<212> PRT
<213> Mouse

<400> 7

Gin Val Lys Leu Gin Gin Ser Gly Ala Glu Leu Val Gly Ser Gly Ala

15 10 1

Ser Val Lys Leu Ser Cys Thr Thr Ser Gly Phe Asn lie Lys Asp Phe

20 25 30

Tyr Met His Trp Val Lys Gin Arg Pro Glu Gin Gly Leu Glu Trp lie

35 40 45

Gly Trp lie Asp Pro Glu Asn Gly Asp Ser Asp Tyr Ala Pro Lys Phe
50 55 60

"In Gly Lys Ala Thr Met Thr Ala Asp Ser Ser Ser Asn Thr Ala Tyr
-5 70 ^ ^5 80

.^In Leu Ser Ser Leu Thr Ser Glu Asp Tr;r Ala .''-i'^ Tyr Tyr Cys

8 5 90 95

Asn Ala Tyr Tyr Gly Asp Tyr Glu Gl'/ Tyr Tro Glw Gin Gly Thr Thr

100 105 ^ ' ' 110

Val Thr Val Ser Ser
115

<210> 8
<211> 108
<212> PRT
<213> Mouse

<400> 8

Asp lie Glu Leu Thr Gin Ser Pro Ala lie Met Ser Ala Ser Pro Gly
15 10 15

Glu Lys Val Thr lie Thr Cys Ser Ala Ser Ser Ser Val Ser Tyr Met

20 25 30

His Trp Phe Gin Gin Lys Pro Gly Thr Ser Pro Lys Leu Trp lie Tyr

35 40 45

Ser Thr Ser Asn Leu Ala Ser Gly Val Pro Ala Arg Phe Ser Gly Ser
50 55 60

Gly Ser Gly Thr Ser Tyr Ser Leu Thr lie Ser Arg Met Glu Ala Glu
65 70 75 80

wo 01/54723 PCT/USOl/02839

Asp Ala Ala Thr

Phe Giy Ser Gly

100

Tyr Tyr Cys Gin
85

Thr Lys Leu Glu

Gin Arg Ser Ser
90

lie Lys Arg Ala
105

Tyr Pro Phe Th -

<210> 9
<211> 30
<212> DNA
<213> Mouse

<400> 9

ggcttcaaca ttaaagactt ctatatgcac 30

<210> 10
<211> 51
<212> DNA
<213> Mouse

<400> 10

tggattgatc ctgagaatgq tgattctgat tatgccccga agttccaggg c 51

<210> 11
<211> 24
<212> DNA
<213> Mouse

<400> 11

tactatggtg actacgaagg ctac 24

<21C> 12

<^12> DNA
<213> Mouse

< 4 0 0 > 12

agtgccagct caagtgtaag ttacatgcac 30

<210> 13
<211> 21
<212> DNA
<213> Mouse

<400> 13

agcacatcca acctggcttc t 21

<210> 14
<211> 27
<212> DNA
<213> Mouse

<400> 14

cagcaaagga gtagttaccc attcacg 27

<210> 15
<211> 351
<212> DNA
<213> Mouse

wo 01/54723

PCT/USOl/02839

<400> 15

caggtcaagc tgcagcagtc tggggcagag cttgtggggt caggggcctc agtcaaattg 60

tcctgcacaa cttctggctt caacattaaa gacttctata tgcactgggt gaagcagagg 120

cctgaacagg gcctggagtg gattggatgg attgatcctg agaatggtga ttctgattat 180

gccccgaagt tccagggcaa ggccaccatg actgcagact catcctccaa cacagcctac 240

ctgcagctca gcagcctgac atctgaggac actgccgtct attactgtaa tgcatactat 300

ggtgactacg aaggctactg gggccaaggg accacggtca ccgcctcctc a 351

<210> 16
<211> 324
<212> DNA
<213> Mouse

<400> 16

gacatcgagc tcactcagtc tccagcaatc atgtctgcat ctccagggga gaaggtcacc 60
ataacctgca gtgccagctc aagtgtaagt tacatgcact ggttccagca gaagccaggc 120
acttctccca aactctggat ttatagcaca tccaacctgg cttctggagt ccctgctcgc 180
ttcagtggca gtggatctgg gacctcttac tctctcacaa tcagccgaat ggaggctgaa 240
gatgctgcca cttattactg ccagcaaagg agtagttacc cattcacgtt cggctcgggg 300
accaagctgg aaataaaacg ggcg 324

INTERNATIONAL SEARCH REPORT

International application No.

PCT/USOl/02839

A. CXASSIFICATION OF SUBJECT MATTER

IPC(7) A61K 39/395, 39/00, 39/38; GOIN 33/53

US CL 424/ 130.1, 138.1, 143,1, 184.1; 435/975

According to International Patent Classification (IPC) or to both national classification and IPC

FIELDS SEARCHED

M inimum documentation searched (classification system followed by classification symbols)
U.S. : 424/ 130.1, 138.1, 143.1. 184.1; 435/975

Documentation searched other than minimum docimientation to the extent that such documents are included in the fields searched

Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)
STN, WEST, MEDLINE,

C. DOCUMENTS CONSIDERED TO BE RELEVANT

Internet Archive Audio

Featured

Top

Images

Featured

Top

Software

Featured

Top

Books

Featured

Top

Video

Featured

Top

Mobile Apps

Browser Extensions

Archive-It Subscription

Save Page Now

Full text of "USPTO Patents Application 09993647"

See other formats